Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 765174
End position: 765197
Length: 24

DNA sequence
>NC_011773, from 765174 to 765197 (24 bp); Bacillus cereus AH820 TGTTTGAGTTTGTGATTGTGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 764758-765918	Sequence	BCAH820_0801 - peptidase, M23/M37 family (Protein is coded in complementary strand; from 765918 to 764758)