Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 706019
End position: 706054
Length: 36

DNA sequence
>NC_011773, from 706019 to 706054 (36 bp); Bacillus cereus AH820 TTTTTACTTTGCTTTTTGCTTTACTTTTTACCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 706003-707181	Sequence	BCAH820_0729 - putative multidrug resistance protein (Protein is coded in complementary strand; from 707181 to 706003)