Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 5208901
End position: 5208925
Length: 25

DNA sequence
>NC_011773, from 5208901 to 5208925 (25 bp); Bacillus cereus AH820 TTTCTTCTCTTTTATATTCTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5208794-5210365	Sequence	BCAH820_5507 - sensor histidine kinase (Protein is coded in complementary strand; from 5210365 to 5208794)