Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 5072833
End position: 5072857
Length: 25

DNA sequence
>NC_011773, from 5072833 to 5072857 (25 bp); Bacillus cereus AH820 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5072807-5073013	Sequence	BCAH820_5370 spoIIID stage III sporulation protein D (Protein is coded in complementary strand; from 5073013 to 5072807)