Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4874731
End position: 4874760
Length: 30

DNA sequence
>NC_011773, from 4874731 to 4874760 (30 bp); Bacillus cereus AH820 TTTTTTCATATTTTTTTCTACTTTTTCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4872107-4875352	Sequence	BCAH820_5172 - wall-associated protein (Protein is coded in complementary strand; from 4875352 to 4872107)