Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4550829
End position: 4550852
Length: 24

DNA sequence
>NC_011773, from 4550829 to 4550852 (24 bp); Bacillus cereus AH820 CTTCTTCTACTTCTTCTGCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4548074-4551928	Sequence	BCAH820_4807 - ftsk/spoiiie family protein (Protein is coded in complementary strand; from 4551928 to 4548074)