Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4493895
End position: 4493918
Length: 24

DNA sequence
>NC_011773, from 4493895 to 4493918 (24 bp); Bacillus cereus AH820 TATTCTCTTATGCTCTTGTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4493629-4494324	Sequence	BCAH820_4744 - hypothetical protein (Protein is coded in complementary strand; from 4494324 to 4493629)