Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4458358
End position: 4458381
Length: 24

DNA sequence
>NC_011773, from 4458358 to 4458381 (24 bp); Bacillus cereus AH820 CTTTATTTCTTTGTTTCTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4456947-4458710	Sequence	BCAH820_4703 phoR sensory box histidine kinase PhoR (Protein is coded in complementary strand; from 4458710 to 4456947)