Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4394925
End position: 4394951
Length: 27

DNA sequence
>NC_011773, from 4394925 to 4394951 (27 bp); Bacillus cereus AH820 GTTGCTCCTGTTGCTCCTGTTGCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4394301-4395383	Sequence	BCAH820_4639 - collagen triple helix repeat domain protein (Protein is coded in complementary strand; from 4395383 to 4394301)