Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 4174036
End position: 4174071
Length: 36

DNA sequence
>NC_011773, from 4174036 to 4174071 (36 bp); Bacillus cereus AH820 TTGTTCTTTTTCTTCTTCTTTTTCTTCTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4173593-4174534	Sequence	BCAH820_4408 - DnaD domain protein (Protein is coded in complementary strand; from 4174534 to 4173593)