Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 3970289
End position: 3970324
Length: 36

DNA sequence
>NC_011773, from 3970289 to 3970324 (36 bp); Bacillus cereus AH820 CTTGCTCTGCAACTTGCATTGCAACTTGCTCTCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3969586-3970380	Sequence	BCAH820_4158 - short-chain dehydrogenase/reductase family oxidoreductase (Protein is coded in complementary strand; from 3970380 to 3969586)