Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 3821425
End position: 3821448
Length: 24

DNA sequence
>NC_011773, from 3821425 to 3821448 (24 bp); Bacillus cereus AH820 CAAGTGCAAGTCCAACTGCAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3820665-3821642	Sequence	BCAH820_3986 pdhB pyruvate dehydrogenase complex E1 component subunit beta (Protein is coded in complementary strand; from 3821642 to 3820665)