Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 3743316
End position: 3743339
Length: 24

DNA sequence
>NC_011773, from 3743316 to 3743339 (24 bp); Bacillus cereus AH820 AATCTTCAAACCTTCAAATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3742852-3743766	Sequence	BCAH820_3903 pyrB aspartate carbamoyltransferase catalytic subunit (Protein is coded in complementary strand; from 3743766 to 3742852)