Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 3496263
End position: 3496286
Length: 24

DNA sequence
>NC_011773, from 3496263 to 3496286 (24 bp); Bacillus cereus AH820 TATCAACATCAATAGCAATAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3495191-3496849	Sequence	BCAH820_3661 hutU urocanate hydratase (Protein is coded in complementary strand; from 3496849 to 3495191)