Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 3048427
End position: 3048465
Length: 39

DNA sequence
>NC_011773, from 3048427 to 3048465 (39 bp); Bacillus cereus AH820 TATTACTATTTTTTATTACTATTTTTTATTACTAATGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3048433-3050286	Sequence	BCAH820_3211 - mxaA domain protein (Protein is coded in complementary strand; from 3050286 to 3048433)