Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 2982009
End position: 2982032
Length: 24

DNA sequence
>NC_011773, from 2982009 to 2982032 (24 bp); Bacillus cereus AH820 GGCTGCGGCTGCGGCTGCGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2981602-2982927	Sequence	BCAH820_3147 - hemolysin BL lytic component L2 (Protein is coded in complementary strand; from 2982927 to 2981602)