Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 2711862
End position: 2711885
Length: 24

DNA sequence
>NC_011773, from 2711862 to 2711885 (24 bp); Bacillus cereus AH820 ATAAATATAAACATGAATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2711625-2711876	Sequence	BCAH820_2858 divIC2 cell division protein DivIC (Protein is coded in complementary strand; from 2711876 to 2711625)