Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 2447273
End position: 2447296
Length: 24

DNA sequence
>NC_011773, from 2447273 to 2447296 (24 bp); Bacillus cereus AH820 AAAGATAAAAATATAAAACGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2446336-2447352	Sequence	BCAH820_2572 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 2447352 to 2446336)