Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 2351398
End position: 2351422
Length: 25

DNA sequence
>NC_011773, from 2351398 to 2351422 (25 bp); Bacillus cereus AH820 TTTTTTGTTTTTTTATTATTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2351414-2351572	Sequence	BCAH820_2473 - hypothetical protein (Protein is coded in complementary strand; from 2351572 to 2351414)