Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 2348285
End position: 2348317
Length: 33

DNA sequence
>NC_011773, from 2348285 to 2348317 (33 bp); Bacillus cereus AH820 TTATTTTGTTTTGATTTTGTTGTTTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2347225-2348613	Sequence	BCAH820_2469 - GTP pyrophosphokinase (Protein is coded in complementary strand; from 2348613 to 2347225)