Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 1858999
End position: 1859033
Length: 35

DNA sequence
>NC_011773, from 1858999 to 1859033 (35 bp); Bacillus cereus AH820 ACTTCACTTCACTTCACTTCACTTCACTTCACTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1859023-1859928	Sequence	BCAH820_1951 - transporter EamA family (Protein is coded in complementary strand; from 1859928 to 1859023)