Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 173115
End position: 173159
Length: 45

DNA sequence
>NC_011773, from 173115 to 173159 (45 bp); Bacillus cereus AH820 TTCCGTTTTTTTATCTTCCGTTTTCTTGTCTTCAGATTTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 172021-173322	Sequence	BCAH820_0192 - putative lipoprotein (Protein is coded in complementary strand; from 173322 to 172021)