Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 1548664
End position: 1548687
Length: 24

DNA sequence
>NC_011773, from 1548664 to 1548687 (24 bp); Bacillus cereus AH820 TTGTTGTTGTTCTTGCTGCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1548608-1551301	Sequence	BCAH820_1643 - penicillin-binding protein (Protein is coded in complementary strand; from 1551301 to 1548608)