Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 1463915
End position: 1463941
Length: 27

DNA sequence
>NC_011773, from 1463915 to 1463941 (27 bp); Bacillus cereus AH820 CCCAGTAGCGCCAGTAGCGCCAGTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1462533-1464071	Sequence	BCAH820_1549 - group-specific protein (Protein is coded in complementary strand; from 1464071 to 1462533)