Sequence retrieval

Genome: Bacillus cereus AH820
Start position: 1319647
End position: 1319691
Length: 45

DNA sequence
>NC_011773, from 1319647 to 1319691 (45 bp); Bacillus cereus AH820 TTCAGCAGGCTTTTGCTCGGCAGGTTTTTGCTCAACAGGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1319165-1319992	Sequence	BCAH820_1384 - hypothetical protein (Protein is coded in complementary strand; from 1319992 to 1319165)