Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4476733
End position: 4476786
Length: 54

DNA sequence
>NC_011772, from 4476733 to 4476786 (54 bp); Bacillus cereus G9842 CCTTGGTTGTCGTTTCCGCCTTGGTTGTCGTTTCCGCCTTGGTTGTCGTTTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4475998-4478823	Sequence	BCG9842_B0581 - cell surface protein (Protein is coded in complementary strand; from 4478823 to 4475998)