Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3264926
End position: 3264979
Length: 54

DNA sequence
>NC_011772, from 3264926 to 3264979 (54 bp); Bacillus cereus G9842 TTCCTGTTGCTCCTGTTGCTCCTGTCGCCCCTGTTGCCCCTGTTGCTCCTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3263410-3265917	Sequence	BCG9842_B1866 - hypothetical protein (Protein is coded in complementary strand; from 3265917 to 3263410)