Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 2882293
End position: 2882346
Length: 54

DNA sequence
>NC_011772, from 2882293 to 2882346 (54 bp); Bacillus cereus G9842 TCTTCTTTAACTTTTACTTCTTCTTTGACTTTTGCCTCTTCTTTAGGCTTTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2881408-2882910	Sequence	BCG9842_B2273 - enterotoxin (Protein is coded in complementary strand; from 2882910 to 2881408)