Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 948306
End position: 948350
Length: 45

DNA sequence
>NC_011772, from 948306 to 948350 (45 bp); Bacillus cereus G9842 AACCTAAACAAGAAAACACTAAACAGGAAAACACTAAACAAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 948027-948614	Sequence	BCG9842_B4318 - lpxtg-motif cell wall anchor domain-containing protein