Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3630594
End position: 3630638
Length: 45

DNA sequence
>NC_011772, from 3630594 to 3630638 (45 bp); Bacillus cereus G9842 TTTGTATATTAGTATTTCGTTTATTAGTAGTTATTCTATTAGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3630116-3631003	Sequence	BCG9842_B1507 - phage replication protein (Protein is coded in complementary strand; from 3631003 to 3630116)