Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 1248820
End position: 1248864
Length: 45

DNA sequence
>NC_011772, from 1248820 to 1248864 (45 bp); Bacillus cereus G9842 TTCTTCAGCAGGCTTTTGCTCAGCAGGTTTTTGCTCAGCAGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1248434-1249246	Sequence	BCG9842_B3998 - hypothetical protein (Protein is coded in complementary strand; from 1249246 to 1248434)