Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 5136353
End position: 5136388
Length: 36

DNA sequence
>NC_011772, from 5136353 to 5136388 (36 bp); Bacillus cereus G9842 TCTTGTTTTTTCTCTTCCTTTTTCTCTTCTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5135714-5136544	Sequence	BCG9842_B5567 - epsx protein (Protein is coded in complementary strand; from 5136544 to 5135714)