Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4100239
End position: 4100274
Length: 36

DNA sequence
>NC_011772, from 4100239 to 4100274 (36 bp); Bacillus cereus G9842 TTGTGGTATTTGTGGTATTTGTGGTATTTGTGGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4100156-4100389	Sequence	BCG9842_B1000 - hypothetical protein (Protein is coded in complementary strand; from 4100389 to 4100156)