Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3777687
End position: 3777722
Length: 36

DNA sequence
>NC_011772, from 3777687 to 3777722 (36 bp); Bacillus cereus G9842 GTTCTTCTTGTTGTTGTTCTTTTTCTTCTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3777257-3778207	Sequence	BCG9842_B1357 - DnaD domain protein (Protein is coded in complementary strand; from 3778207 to 3777257)