Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3226081
End position: 3226116
Length: 36

DNA sequence
>NC_011772, from 3226081 to 3226116 (36 bp); Bacillus cereus G9842 TGGTGGTACTGGTGGTGGTACTGGTGGTGGCACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3225773-3226621	Sequence	BCG9842_B1912 - lipoprotein (Protein is coded in complementary strand; from 3226621 to 3225773)