Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 2684643
End position: 2684678
Length: 36

DNA sequence
>NC_011772, from 2684643 to 2684678 (36 bp); Bacillus cereus G9842 CAATCCCAATTATAATCCCAATCACAATTCCGATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2684627-2684794	Sequence	BCG9842_B2499 - hypothetical protein (Protein is coded in complementary strand; from 2684794 to 2684627)