Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 629300
End position: 629332
Length: 33

DNA sequence
>NC_011772, from 629300 to 629332 (33 bp); Bacillus cereus G9842 AATAAGGAATAAAGAAGAAATAAAAAAGGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 629258-630364	Sequence	BCG9842_B4667 gerKB spore germination protein GerKB (Protein is coded in complementary strand; from 630364 to 629258)