Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 2931539
End position: 2931568
Length: 30

DNA sequence
>NC_011772, from 2931539 to 2931568 (30 bp); Bacillus cereus G9842 TAGCTTTTTATATTTTTTTATATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2931567-2932784	Sequence	BCG9842_B2221 - acetylornithine aminotransferase (Protein is coded in complementary strand; from 2932784 to 2931567)