Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4647976
End position: 4648002
Length: 27

DNA sequence
>NC_011772, from 4647976 to 4648002 (27 bp); Bacillus cereus G9842 CCTGTCGCTCCTGTTGCTCCTGTAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4647385-4650240	Sequence	BCG9842_B0398 - hypothetical protein (Protein is coded in complementary strand; from 4650240 to 4647385)