Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3642339
End position: 3642365
Length: 27

DNA sequence
>NC_011772, from 3642339 to 3642365 (27 bp); Bacillus cereus G9842 GGTGCTACTGGTGCCACTGGCGCTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3641944-3642942	Sequence	BCG9842_B1494 - hypothetical protein (Protein is coded in complementary strand; from 3642942 to 3641944)