Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3268038
End position: 3268064
Length: 27

DNA sequence
>NC_011772, from 3268038 to 3268064 (27 bp); Bacillus cereus G9842 CCTTGTATTCCTTGTATGCCCTGTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3265944-3268460	Sequence	BCG9842_B1865 - hypothetical protein (Protein is coded in complementary strand; from 3268460 to 3265944)