Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3133633
End position: 3133659
Length: 27

DNA sequence
>NC_011772, from 3133633 to 3133659 (27 bp); Bacillus cereus G9842 TTTGTTTGTTTTGTTTGTTTCGTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3132823-3133782	Sequence	BCG9842_B2020 - beta-lactamase (Protein is coded in complementary strand; from 3133782 to 3132823)