Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 1207751
End position: 1207777
Length: 27

DNA sequence
>NC_011772, from 1207751 to 1207777 (27 bp); Bacillus cereus G9842 TTTCGGTTCTTTTGGTTCTTGCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1207380-1207811	Sequence	BCG9842_B4038 - group-specific protein (Protein is coded in complementary strand; from 1207811 to 1207380)