Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 1173501
End position: 1173527
Length: 27

DNA sequence
>NC_011772, from 1173501 to 1173527 (27 bp); Bacillus cereus G9842 CCAGTAGCCCCAGTAGCCCCAGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1173033-1173977	Sequence	BCG9842_B4079 - BclA protein (Protein is coded in complementary strand; from 1173977 to 1173033)