Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 770636
End position: 770660
Length: 25

DNA sequence
>NC_011772, from 770636 to 770660 (25 bp); Bacillus cereus G9842 TTTTTATTTTTTTCTTATTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 769507-770706	Sequence	BCG9842_B4498 - transcription antiterminator, LytR family (Protein is coded in complementary strand; from 770706 to 769507)