Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 5153945
End position: 5153969
Length: 25

DNA sequence
>NC_011772, from 5153945 to 5153969 (25 bp); Bacillus cereus G9842 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5153919-5154125	Sequence	BCG9842_B5549 spoIIID stage III sporulation protein D (Protein is coded in complementary strand; from 5154125 to 5153919)