Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 698395
End position: 698418
Length: 24

DNA sequence
>NC_011772, from 698395 to 698418 (24 bp); Bacillus cereus G9842 TCTGCTTCTGCATATGCTTTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 697438-698853	Sequence	BCG9842_B4599 - amino-acid permease RocC (Protein is coded in complementary strand; from 698853 to 697438)