Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4997058
End position: 4997081
Length: 24

DNA sequence
>NC_011772, from 4997058 to 4997081 (24 bp); Bacillus cereus G9842 GATGCTGTTGCTGATGCGGATCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4996953-4999391	Sequence	BCG9842_B5709 vacB ribonuclease R (Protein is coded in complementary strand; from 4999391 to 4996953)