Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4735281
End position: 4735304
Length: 24

DNA sequence
>NC_011772, from 4735281 to 4735304 (24 bp); Bacillus cereus G9842 TTCTCTTTTTCTCTTCTTCACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4735058-4735549	Sequence	BCG9842_B0300 - cell surface protein (Protein is coded in complementary strand; from 4735549 to 4735058)