Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 4442109
End position: 4442132
Length: 24

DNA sequence
>NC_011772, from 4442109 to 4442132 (24 bp); Bacillus cereus G9842 TTATCTTTATCCTTATTTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4441041-4442267	Sequence	BCG9842_B0618 - sodium export permease (Protein is coded in complementary strand; from 4442267 to 4441041)